Protein Engineering, Vol. 13, No. 4, 275-281,
April 2000
© 2000 Oxford University Press
On the possibilities and limitations of rational protein design to expand the specificity of restriction enzymes: a case study employing EcoRV as the target
Institut für Biochemie, FB 08, Justus-Liebig-Universität, Heinrich-Buff-Ring 58, D-35392 Giessen, Germany.
| Abstract |
|---|
|
|
|---|
The restriction endonuclease EcoRV has been characterized in structural and functional terms in great detail. Based on this detailed information we employed a structure-guided approach to engineer variants of EcoRV that should be able to discriminate between differently flanked EcoRV recognition sites. In crystal structures of EcoRV complexed with d(CGGGATATCCC)2 and d(AAAGATATCTT)2, Lys104 and Ala181 closely approach the two base pairs flanking the GATATC recognition site and thus were proposed to be a reasonable starting point for the rational extension of site specificity in EcoRV [Horton,N.C. and Perona,J.J. (1998) J. Biol. Chem., 273, 2172121729]. To test this proposal, several single (K104R, A181E, A181K) and double mutants of EcoRV (K104R/A181E, K104R/A181K) were generated. A detailed characterization of all variants examined shows that only the substitution of Ala181 by Glu leads to a considerably altered selectivity with both oligodeoxynucleotide and macromolecular DNA substrates, but not the predicted one, as these variants prefer cleavage of a TA flanked site over all other sites, under all conditions tested. The substitution of Lys104 by Arg, in contrast, which appeared to be very promising on the basis of the crystallographic analysis, does not lead to variants which differ very much from the EcoRV wild-type enzyme with respect to the flanking sequence preferences. The K104R/A181E and K104R/A181K double mutants show nearly the same preferences as the A181E and A181K single mutants. We conclude that even for the very well characterized restriction enzyme EcoRV, properties that determine specificity and selectivity are difficult to model on the basis of the available structural information.
Keywords: DNA recognition/EcoRV/protein engineering/rational protein design/site-directed mutagenesis/specificity
| Introduction |
|---|
|
|
|---|
Type II restriction endonucleases belong to the most important enzymes in molecular biology and molecular medicine. These homodimeric enzymes recognize and cleave DNA in short palindromic sequences comprising 48 base pairs with very high accuracy. Independent of the sequence context, the canonical site is cleaved several orders of magnitude faster than all other sites, including sites which differ at only one base pair from the canonical recognition site (reviews: Roberts and Halford, 1993; Pingoud and Jeltsch, 1997). Today, more than 2000 restriction endonucleases with ~200 different specificities are known, among them only a few with longer than a 6 base pair (bp) recognition site (Roberts and Macelis, 1999
8 bp, therefore, in general do not provide a selective advantage for the bacterial host and in consequence to date only 3.5% of all possible 8 bp cutters are available from natural sources (Roberts and Macelis, 1999
The restriction endonuclease EcoRV (recognition site: GATATC) is one of the best characterized type II restriction enzymes and, therefore, within this class of enzymes is an ideal target for a rational protein design. Besides detailed biochemical analysis (review: Pingoud and Jeltsch, 1997), a wealth of structural information is available for this enzyme including the structure of the free enzyme (Winkler et al., 1993
), a structure of the enzyme bound non-specifically to DNA (Winkler et al., 1993
), different structures of specific EcoRV substrate (Kostrewa and Winkler, 1995
; Perona and Martin, 1997
; Horton and Perona, 1998a
) and EcoRV product complexes (Kostrewa and Winkler, 1995
; Horton and Perona, 1998b
) as well as structures of EcoRV variants bound to specific substrates (Horton and Perona, 1998b
) and of EcoRV bound to modified substrates (Martin et al., 1999
). All these structural studies as well as biochemical studies using chemically modified substrates (Thorogood et al., 1996
) and EcoRV variants (Wenz et al., 1996
) show that EcoRV in addition to contacts with its recognition sequence interacts also with base pairs upstream and downstream of its recognition site. These additional contacts may explain the site preferences of EcoRV observed under certain conditions (Taylor and Halford, 1992
; Lanio et al., 1998
; Schöttler et al., 1998
). Hence it seems to be possible to create new proteinDNA contacts to the base pairs flanking the GATATC recognition site which could enable the nuclease to recognize an extended site comprising up to 10 bp. Crystallographic analyses of EcoRV with short oligodeoxynucleotides differing in the base pairs adjacent to the recognition site, suggest a promising starting point for a rational protein engineering project. Two amino acid residues, Lys104 and Ala181, form water-mediated contacts to the neighboring base pairs upstream (Ala181) and downstream (Lys104) of the recognition site (Horton and Perona, 1998a
). In the complex with d(CGGGATATCCC)2, Lys104 interacts through water molecules with the exocyclic N-4 amino group of the flanking cytosines on the 3'-side of the recognition sequence. These contacts are not seen with the d(AAAGATATCTT)2 substrate, presumably because they are prevented by steric exclusion of water molecules due to the presence of the 5-methyl group of thymine (Horton and Perona, 1998a
). These water-mediated contacts to a base next to the recognition sequence could in principle be replaced by a specific hydrogen bond, if the lysine is replaced by the slightly larger arginine. Changing a water-mediated contact to a specific hydrogen bond should enable the resulting variant to discriminate against substrates which could not provide that additional contact. In the case of Lys104 a change to arginine has been suggested in order to create a direct contact on the 3'-side with the O-4 of a flanking thymine or the O-6 of a flanking guanine (Horton and Perona, 1998a
). On the 5'-side, the side chain of Ala181 points towards the base pair flanking the recognition site. This residue has been investigated by site-directed mutagenesis recently and some of the variants generated were shown to display an extended specificity towards differently flanked sites, such as A181E, A181F, A181I and A181K (Schöttler et al., 1998
). Therefore, combination of variants at positions 104 and 181 appeared to be very promising for the design of an 8 or 10 bp cutter, as discussed by Horton and Perona (1998a) and illustrated in Figure 1
. As shown in Table I
, combinations of different substitutions at positions 104 and 181 should result in several EcoRV variants with an extended specificity towards differently flanked substrates (Horton and Perona, 1998a
). For example, combination of the Lys104 to Arg with the Ala181 to Glu substitution should result in a double mutant with a preference for CGATATCG. We have produced and characterized all the variants given in Table I
. While some of the variants show preferences that are different from the wild-type enzyme, none of them displays the postulated preferences. Furthermore, the combination of amino acid substitutions does not lead to synergistic effects.
|
|
| Materials and methods |
|---|
|
|
|---|
Site-directed mutagenesis of the ecoRV gene, overexpression and purification of mutant proteins
Mutagenesis was performed using a PCR megaprimer technique as described (Roth et al., 1998
). Together with the mutation, one of the PCR primers introduces a characteristic restriction site into the gene to allow for a fast screening of the presence of the mutation. The mutant genes were cleaved with NsiI and SalI and cloned into the plasmid pHis (Wenz et al., 1994
). Both strands of the complete ecoRV gene of all clones were sequenced using an ABI 373 sequencer (Applied Biosystems). Expression of the EcoRV mutants was induced in 3 ml of LB medium at a cell density of 1 OD600 by addition of IPTG to a final concentration of 1 mM. The His6-tagged mutants were purified using Ni-NTA magnetic agarose beads (5% suspension) (Qiagen, Hilden, Germany). Harvested cells were resuspended in 600 µl of binding buffer [30 mM potassium phosphate, pH 7.5, 0.1 mM DTE, 0.01% (w/v) lubrol, 500 mM NaCl, 20 mM imidazole] and after sonication (2x30 s on ice), cell debris was removed by centrifugation and 200 µl of the supernatant were transferred into the wells of a 96-well microplate. A volume of 20 µl of a suspension of agarose beads was added to the supernatant and vortex mixed at 600 r.p.m. for 30 min at 4°C. The microplate was then placed on a 96-well magnet (Qiagen) for 1 min and the supernatant was removed with a pipet. The beads were washed twice with binding buffer. To elute the His6-tagged protein, 50 µl of elution buffer [30 mM potassium phosphate, pH 7.5, 0.1 mM DTE, 0.01% (w/v) lubrol, 500 mM NaCl, 200 mM imidazole] were added and the eluates were collected after placing the microplate on the magnet for 1 min. Protein preparations obtained contained >90% pure EcoRV and were free of contaminating nuclease activity. Typical yields were 5 µg in 50 µl (corresponding to a 12 µM EcoRV solution) starting from a 3 ml of culture. For detailed characterization, larger amounts of certain variants were prepared as described (Wenz et al., 1994
).
DNA-cleavage assays
We employed the following 20mer oligodeoxynucleotides as substrates for EcoRV: 20AT, d(GATCGAAGATATCTTCGATC)2; 20CG, d(GATCGACGATATCGTCGATC)2; 20GC, d(GATCGAGGATATCCTCGATC)2; and 20TA, d(GATCGA-TGATATCATCGATC)2 (the EcoRV recognition sequence is highlighted in bold face and the different nucleotides flanking the recognition site are underlined). All oligodeoxynucleotides were purchased from Interactiva (Ulm, Germany). After purification by denaturing polyacrylamide gel electrophoresis, the oligodeoxynucleotides were labeled at the 5'-end using T4 polynucleotide kinase. If not stated otherwise, all cleavage reactions were carried out in 20 mM TrisHCl, pH 7.5, 50 mM NaCl, 10 mM MgCl2, 100 µg/ml BSA (bovine serum albumin) at ambient temperature.
Reaction mixtures for determination of Km and kcat values contained 0.0110 µM of radioactively labeled oligodeoxynucleotide. Reactions were started by addition of enzyme at a concentration which was at least 10-fold lower than the substrate concentration. After defined time intervals, 2 µl aliquots were withdrawn from the reaction mixture, spotted on to a DEAE-cellulose plate (MachereyNagel, Düren, Germany) and subjected to homochromatography (Brownlee and Sanger, 1969
). For the quantification of substrate and product concentrations, an Instant Imager was used (Canberra Packard). Initial velocities (v0) were calculated from the linear part of individual reaction progress curves obtained at five or more different substrate concentrations. The Km and kcat values were calculated from v0 vs c diagrams by a best fit to the MichaelisMenten equation. Errors were calculated to be within 1030%.
The oligodeoxynucleotides used as substrates for EcoRV (see above) were cloned into the EcoRI site of pUC8 as described (Schöttler et al., 1998
). For the DNA cleavage kinetics, 15 nM plasmid was digested with appropriate dilutions of EcoRV variants (1.5 and 15 nM) at 37°C in the standard cleavage buffer containing 1 or 10 mM MgCl2. After defined time intervals, 15 µl aliquots were withdrawn, the reaction stopped with 5 µl 5-fold gel loading buffer containing 250 mM EDTA and analyzed by agarose gel electrophoresis. After ethidium bromide staining, quantification of substrate and product concentrations was carried out by integration of the intensities of the respective bands on a digitized image. Initial rates (k) were obtained from the linear part of the reaction progress curves.
| Results |
|---|
|
|
|---|
Mutagenesis and expression of the EcoRV variants
EcoRV mutants at positions 104 and 181 were generated by PCR mutagenesis. All mutants and the wild-type enzyme carry an N-terminal His6 tag which allows purification by affinity chromatography using Ni-NTA agarose beads. A volume of 3 ml of Escherichia coli cell culture on average yielded 5 µg of a recombinant protein preparation of >90% purity as judged by SDSPAGE.
Cleavage of oligodeoxynucleotides
To measure the preferences of wild-type EcoRV and the EcoRV variants for flanking sequences, cleavage experiments were performed with four self-complementary 20mer oligodeoxynucleotides which differ from each other only in the neighboring positions 5' and 3' to the GATATC recognition site. The results of the cleavage experiments are summarized in Table II
. As described previously (Schöttler et al., 1998
), the wild-type enzyme cleaves the oligodeoxynucleotides with a CG, GC and TA flanked recognition site with almost the same rate (kcat/KM) and the oligodeoxynucleotide with the AT flanked recognition site more slowly. Unlike the wild-type enzyme, the K104R variant cleaves the AT flanked site with a high activity and slightly disfavors the GC flanked site (Figure 2
). It had been predicted by Horton and Perona (1998a) that this variant forms a contact to the O4 of a thymine or to the O6 of a guanine flanking the recognition sequence at the 3'-side. However, whereas CG-flanked sites are preferred over AT-flanked sites by the wild-type enzyme, this preference is lost for the K104R variant, indicating that K104R presumably does not form the postulated contact to the O6 of guanine or, if it does, that this contact is not accompanied by a preference for AT- and CG-flanked EcoRV sites. A different result had been obtained for the A181K and A181E variants (Schöttler et al., 1998
): the A181K variant prefers sites flanked by a purine at the 5'-side, most probably due to a hydrogen bond between the amino group of the lysine side chain and N7 of purine and cleaves the CG- and TA-flanked sites more than one order of magnitude more slowly than the GC-flanked site (Table II
, Figure 2
). In contrast, the A181E variant strongly prefers sites with a pyrimidine at the 5'-side and cleaves the TA-flanked site at least 10 times faster than sites with a purine at the 5'-side, albeit displaying a very low catalytic activity compared with the wild-type enzyme (Table II
, Figure 2
). The decrease in catalytic activity can be explained by the additional charge of a deprotonated glutamic acid residue within the proteinDNA interface, which is likely to disturb substrate binding (increase in KM) but not necessarily the catalytic step (unaltered kcat). The residual activity and the high specificity of the variant can be explained by a hydrogen bond between the partially protonated carboxylate of Glu181 and O4 of thymine (Schöttler et al., 1998
).
|
|
According to the suggestion of Horton and Perona (1998a), the double mutant K104R/A181E should strongly prefer the CG-flanked substrate, whereas K104R/A181K should cleave an AT-flanked site much faster than all other sites (Table I
Arg with the substitution Ala181
Glu and Ala181
Lys, respectively, leads only to minor alterations in the kinetic parameters of the EcoRV variants. Cleavage of macromolecular substrates
To analyze whether macromolecular substrates are cleaved with the same preferences as oligodeoxynucleotide substrates, steady-state and pre-steady-state cleavage experiments with plasmids containing the four different 20mer oligodeoxynucleotide sequences were performed (Table III
, Figure 3
). The wild-type enzyme, the K104R and the A181K variants display hardly any selectivity towards differently flanked EcoRV sites, under both steady-state and single-turnover conditions. Only at low MgCl2 concentrations does A181K display the same preference with plasmid substrates as with oligodeoxynucleotide substrates. The A181K variant, however, is considerably less active than the wild-type enzyme with macromolecular substrates. The enzymatic activity of the A181K variant is restored to wild-type level by the additional substitution of Lys104 by Arg whereas the selectivity observed at low MgCl2 concentration is lost. The resulting double mutant has wild-type activity under steady-state conditions and displays, like the wild-type enzyme and the single mutant, little preference regarding the 5'- and 3'-flanking regions. Under-single turnover conditions with 10 mM MgCl2, the K104R single mutant is less active than the wild-type enzyme, but, like the wild-type enzyme, has almost no preferences for flanking regions. In contrast, the activity and selectivity of the A181E mutant are higher with macromolecular substrates than with oligodeoxynucleotide substrates. The low activity of A181E with oligodeoxynucleotides is mainly due to a high Km. Presumably, this deficiency is not observed with plasmids, because macromolecular DNA has a higher surface density of negative charge than oligodeoxynucleotides (Zhang et al., 1996
), resulting in an improved substrate binding. The additional substitution of Lys104 by arginine in the A181E context does not have a major influence regarding the cleavage of plasmid substrates.
|
|
The strong increase of the wild-type activity under single-turnover conditions compared with steady-state conditions reveals product dissociation to be the rate-limiting step for the cleavage reaction. In contrast, the rate of DNA cleavage by all variants is not increased under single-turnover conditions, indicating that for them the catalytic step or a step preceding it is rate limiting.
| Discussion |
|---|
|
|
|---|
In spite of the availability of detailed structural data, rational protein design with type II restriction endonucleases as targets turns out to be very difficult. The recognition process that leads to the activation of the catalytic centers of restriction enzymes is highly redundant and involves not only hydrogen bonds and van der Waals contacts to the bases of the recognition site (direct readout), but also a multitude of interactions, some of them water mediated, between the protein and the sugarphosphate backbone of the DNA (indirect readout) (Rosenberg, 1991
We conclude that on the basis of structures of enzymesubstrate complexes, it seems to be very difficult to predict amino acid exchanges that would lead to an extended specificity. One reason for the problems encountered could be that in the co-crystals obtained so far, EcoRV cannot be activated by Mg2+ ions soaked into the crystals. Thus, structures of wild-type EcoRV or certain variants complexed to their specific substrate do not necessarily represent the ground state of the enzymatic reaction. If they did, it could be that the designed mutations cannot provide much additional discrimination, possibly because one or two additional hydrogen bonding contacts using long side chains are not sufficient. More important, however, no structural information on the transition state of EcoRV is available, such that predictions regarding the effects of single amino acid substitutions are unreliable. We believe that generating EcoRV variants with extended specificity by protein engineering requires the design of cooperative conformational changes that couple recognition to catalysis. The amino acid substitutions required to facilitate such conformational changes can hardly be predicted. At present, our lack of understanding of the key steps, together with a thorough evaluation of their entropic and enthalpic contributions, in the mechanism of action of EcoRV which lead to the activation of the catalytic centers prevents a successful rational protein design for target site expansion of EcoRV and requires random mutagenesis/selection approaches. In fact, directed evolution approaches have already been demonstrated to be successful for the generation of EcoRV variants with extended specificity (Lanio et al., 1998
)
| Notes |
|---|
1 To whom correspondence should be addressed E-mail: alfred.m.pingoud{at}chemie.bio.uni-giessen.de
| Acknowledgments |
|---|
We thank Dr J.Perona for communicating results prior to publication. The financial support of the Deutsche Forschungsgemeinschaft, the Bundesministerium für Bildung, Wissenschaft, Forschung und Technologie and the European Community is gratefully acknowledged.
| References |
|---|
|
|
|---|
Brownlee,G.G. and Sanger,F. (1969) Eur J Biochem., 11, 395399.[ISI][Medline]
Horton,N.C. and Perona,J.J. (1998a) J. Biol. Chem., 273, 2172121729.
Horton,N.C. and Perona,J.J. (1998b) J. Mol. Biol., 277, 779787.[ISI][Medline]
Jeltsch,A., Wenz,C., Wende,W., Selent,U. and Pingoud,A. (1996) Trends Biotechnol., 14, 235238.[ISI][Medline]
Kostrewa,D. and Winkler,F.K. (1995) Biochemistry, 34, 683696.[Medline]
Lanio,T., Selent,U., Wenz,C., Wende,W., Schulz,A., Adiraj,M., Katti,S.B. and Pingoud,A. (1996) Protein Engng, 9, 10051010.
Lanio,T., Jeltsch,A. and Pingoud,A. (1998) J. Mol. Biol., 283, 5969.[ISI][Medline]
Martin,A.M., Horton,N.C., Lusetti,S., Reich,N.O. and Perona,J.J. (1999) Biochemistry, 38, 84308439.[Medline]
Newman,M., Strzelecka,T., Dorner,L.F., Schildkraut,I. and Aggarwal,A.K. (1995) Science, 269, 656663.
Newman,M., Lunnen,K., Wilson,G., Greci,J., Schildkraut,I. and Phillips,S.E. (1998) EMBO J., 17, 54665476.[ISI][Medline]
Perona,J.J. and Martin,A.M. (1997) J. Mol. Biol., 273, 207225.[ISI][Medline]
Pingoud,A. and Jeltsch,A. (1997) Eur. J. Biochem., 246, 122.[ISI][Medline]
Roberts,R.J. and Halford,S.E. (1993) Nucleases. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp. 3588.
Roberts,R.J. and Macelis,D. (1999) Nucleic Acids Res., 27, 312313.
Rosenberg,J.M. (1991) Curr. Opin. Struct. Biol., 1, 104113.
Roth,M., Helm-Kruse,S., Friedrich,T. and Jeltsch,A. (1998) J. Biol. Chem., 273, 1733317342.
Schöttler,S., Wenz,C., Lanio,T., Jeltsch,A. and Pingoud,A. (1998) Eur. J. Biochem., 258, 184191.[ISI][Medline]
Taylor,J.D. and Halford,S.E. (1992) Biochemistry, 31, 9097.[Medline]
Thorogood,H., Grasby,J.A. and Connolly,B.A. (1996) J. Biol. Chem., 271, 88558862.
Wah,D.A., Hirsch,J.A., Dorner,L.F., Schildkraut,I. and Aggarwal,A.K. (1997) Nature, 388, 97100.[Medline]
Wenz,C., Selent,U., Wende,W., Jeltsch,A., Wolfes,H. and Pingoud,A. (1994) Biochim. Biophys. Acta, 1219, 7380.[Medline]
Wenz,C., Jeltsch,A. and Pingoud,A. (1996) J. Biol. Chem., 271, 55655573.
Winkler,F.K., Banner,D.W., Oefner,C., Tsernoglou,D., Brown,R.S., Heathman,S.P., Bryan,R.K., Martin,P.D., Petratos,K. and Wilson,K.S. (1993) EMBO J., 12, 17811795.[ISI][Medline]
Zhang,W., Bond,J.P., Anderson,C.F., Lohman,T.M. and Record,M.T., Jr (1996) Proc. Natl Acad. Sci. USA, 93, 25112516.
Received November 1, 1999; revised January 18, 2000; accepted February 8, 2000.
![]()
CiteULike
Connotea
Del.icio.us What's this?
This article has been cited by other articles:
![]() |
J. Smith, S. Grizot, S. Arnould, A. Duclert, J.-C. Epinat, P. Chames, J. Prieto, P. Redondo, F. J. Blanco, J. Bravo, et al. A combinatorial approach to create artificial homing endonucleases cleaving chosen sequences Nucleic Acids Res., December 2, 2006; 34(22): e149 - e149. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Samuelson, R. D. Morgan, J. S. Benner, T. E. Claus, S. L. Packard, and S.-y. Xu Engineering a rare-cutting restriction enzyme: genetic screening and selection of NotI variants Nucleic Acids Res., February 2, 2006; 34(3): 796 - 805. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. A. Chmiel, M. Radlinska, S. D. Pawlak, D. Krowarsch, J. M. Bujnicki, and K. J. Skowronek A theoretical model of restriction endonuclease NlaIV in complex with DNA, predicted by fold recognition and validated by site-directed mutagenesis and circular dichroism spectroscopy Protein Eng. Des. Sel., April 1, 2005; 18(4): 181 - 189. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. M. Cohen, D. S. Tawfik, and A. D. Griffiths Altering the sequence specificity of HaeIII methyltransferase by directed evolution using in vitro compartmentalization Protein Eng. Des. Sel., January 1, 2004; 17(1): 3 - 11. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Pingoud and A. Jeltsch Structure and function of type II restriction endonucleases Nucleic Acids Res., September 15, 2001; 29(18): 3705 - 3727. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||




